Sphingomyelin (d38:2) Levels

Other 17 variants 2 genes

Upload your DNA to see your personal risk score for Sphingomyelin (d38:2) Levels.

Associated Genes (2)
Associated Variants (17)
RSID Gene Risk Allele Odds Ratio Evidence
RS5742904 APOB T 0.93 moderate
RS151193598 A 0.52 moderate
RS187918276 C 0.52 moderate
RS190671241 G 0.51 moderate
RS181372486 A 0.46 moderate
RS138270540 C 0.39 moderate
RS113298164 LIPC T 0.37 moderate
RS139911601 T 0.31 moderate
RS2336171 C 0.27 moderate
RS147599379 CCAGGAAACAGCAAGATTGTGTGG 0.26 moderate
RS117844599 A 0.21 moderate
RS34212714 CA 0.16 moderate
RS58367757 TGACTGGCACTCAGCA 0.16 moderate
RS174556 T 0.14 moderate
RS174555 C 0.14 moderate
RS623607 A 0.12 moderate
RS1169306 T 0.12 moderate
Sign Up to Analyze Your DNA Log In