Sterol Ester (27:1/18:0) Levels

Other 16 variants 1 gene

Upload your DNA to see your personal risk score for Sterol Ester (27:1/18:0) Levels.

Associated Genes (1)
Associated Variants (16)
RSID Gene Risk Allele Odds Ratio Evidence
RS17725246 C exploratory
RS144944992 T 0.49 moderate
RS2280696 T 0.25 moderate
RS11170421 G 0.25 moderate
RS115019703 G 0.22 moderate
RS992108547 A 0.16 moderate
RS2072114 G 0.13 moderate
RS429358 APOE C 0.13 moderate
RS398017699 TA 0.13 moderate
RS72786786 A 0.13 moderate
RS3816117 T 0.12 moderate
RS97384 T 0.12 moderate
RS217386 A 0.12 moderate
RS4246215 T 0.11 moderate
RS55660824 ACTGGCCACTGGGCCAAGGAATGCCTGCAGCC 0.11 moderate
RS56228609 T 0.1 moderate
Sign Up to Analyze Your DNA Log In