RS66927685 Unknown gene

Other Chr ?:?
Upload your DNA to see your genotype for this variant.
GWAS Studies (10)
Trait Risk Allele OR / Beta P-value Study
Alkaline phosphatase (UKB data field 30610) TGAACCTTAGAGACTGAAGAA β: 0.038 1E-101 PubMed
Intrahepatic cholestasis of pregnancy T OR: 1.42 8E-16 PubMed
NCS1 protein levels TGAACCTTAGAGACTGAAGAA β: 0.037 5E-13 PubMed
Triglyceride levels in IDL T β: 0.027 8E-11 PubMed
Triglyceride levels in large LDL T β: 0.026 2E-10 PubMed
Triglyceride levels in LDL T β: 0.025 2E-9 PubMed
Total lipid levels in very small VLDL T β: 0.024 1E-8 PubMed
Phospholipid levels in very small VLDL T β: 0.023 1E-8 PubMed
Triglyceride levels in very small VLDL T β: 0.023 2E-8 PubMed
Concentration of very small VLDL particles T β: 0.023 3E-8 PubMed
Ask Dr. Hemsworth about this variant