RS6147688 Unknown gene

Other Chr ?:?
Upload your DNA to see your genotype for this variant.
GWAS Studies (3)
Trait Risk Allele OR / Beta P-value Study
IL5RA protein levels TAAAGATTTATTCTCTAAAG β: 0.097 4E-34 PubMed
Basophil count TAAAGATTTATTCTCTAAAG β: 0.054 1E-24 PubMed
Eosinophil percentage of white cells TAAAGATTTATTCTCTAAAG β: 0.023 5E-11 PubMed
Ask Dr. Hemsworth about this variant