RS141968686 Unknown gene

Other Chr ?:?
Upload your DNA to see your genotype for this variant.
GWAS Studies (2)
Trait Risk Allele OR / Beta P-value Study
Impedance of whole body (UKB data field 23106) AGCCTCCAGGAAGAGCCTATGG β: 0.013 2E-17 PubMed
Impedance of arm left (UKB data field 23110) AGCCTCCAGGAAGAGCCTATGG β: 0.01 6E-13 PubMed
Ask Dr. Hemsworth about this variant