RS139566989 Unknown gene
Upload your DNA to see your genotype for this variant.
GWAS Studies (20)
| Trait | Risk Allele | OR / Beta | P-value | Study |
|---|---|---|---|---|
| Total cholesterol levels | CGCTGCTCCAAAGAGCAGCT | β: 0.082 | 3E-84 | PubMed |
| 1-palmitoyl-2-linoleoyl-GPE (16:0/18:2) levels | C | OR: 0.33 | 1E-74 | PubMed |
| Total free cholesterol levels | C | β: 0.09 | 3E-74 | PubMed |
| Cholesteryl esters to total lipids ratio in chylomicrons and extremely large VLDL | C | β: 0.091 | 4E-71 | PubMed |
| Free cholesterol levels in IDL | C | β: 0.084 | 2E-65 | PubMed |
| Total cholesterol levels | C | β: 0.082 | 4E-63 | PubMed |
| Total esterified cholesterol levels | C | β: 0.078 | 5E-58 | PubMed |
| Polyunsaturated fatty acids to monounsaturated fatty acids ratio | C | — | 5E-33 | PubMed |
| Polyunsaturated fatty acids to total fatty acids percentage | C | — | 2E-31 | PubMed |
| Total lipid levels in large LDL | C | β: 0.055 | 2E-28 | PubMed |
| Cholesteryl ester levels in large LDL | C | β: 0.048 | 2E-21 | PubMed |
| Cholesterol levels in large LDL | C | β: 0.045 | 2E-19 | PubMed |
| Linoleic acid to total fatty acids percentage | C | — | 9E-19 | PubMed |
| Direct low density lipoprotein levels (UKB data field 30780) | CGCTGCTCCAAAGAGCAGCT | β: 0.021 | 3E-17 | PubMed |
| Matrix-remodeling-associated protein 8 levels | — | OR: 0.14 | 4E-17 | PubMed |
| 1-palmitoyl-2-oleoyl-gpc (16:0/18:1) levels | — | β: 0.096 | 1E-14 | PubMed |
| Alanine aminotransferase levels | CGCTGCTCCAAAGAGCAGCT | β: 0.015 | 1E-12 | PubMed |
| 1-(1-enyl-palmitoyl)-2-oleoyl-gpc (p-16:0/18:1) levels | — | β: 0.087 | 3E-12 | PubMed |
| 1-(1-enyl-palmitoyl)-2-oleoyl-GPE (P-16:0/18:1) levels | — | β: 0.085 | 1E-11 | PubMed |
| Phospholipid levels in large LDL | C | β: 0.028 | 2E-8 | PubMed |