RS3831317 Unknown gene
Upload your DNA to see your genotype for this variant.
What This Variant Does
"A Polymorphism in the Chitotriosidase Gene Associated with Risk of Mycetoma Due to Madurella mycetomatis Mycetoma-A Retrospective Study"
GWAS Studies (1)
| Trait | Risk Allele | OR / Beta | P-value | Study |
|---|---|---|---|---|
| Chitotriosidase-1 levels | CAGACCATGGCCCCGCCCAGTCCCT | OR: 1.1 | 2E-277 | PubMed |