RS371362985 Unknown gene

Other Chr ?:?
Upload your DNA to see your genotype for this variant.
GWAS Studies (3)
Trait Risk Allele OR / Beta P-value Study
Valine levels TGTTAGTCACTGAGGGCACAA β: 0.02 7E-16 PubMed
Total concentration of branched-chain amino acids (leucine + isoleucine + valine) TGTTAGTCACTGAGGGCACAA β: 0.01 9E-12 PubMed
Hip circumference adjusted for BMI T β: 0.018 2E-8 PubMed
Ask Dr. Hemsworth about this variant