RS144926613 Unknown gene
Upload your DNA to see your genotype for this variant.
GWAS Studies (6)
| Trait | Risk Allele | OR / Beta | P-value | Study |
|---|---|---|---|---|
| Haematocrit percentage (UKB data field 30030) | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.021 | 4E-32 | PubMed |
| Cholesteryl Esters in Small VLDL | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.02 | 2E-14 | PubMed |
| Triglycerides to Total Lipids in Small VLDL percentage | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.01 | 8E-12 | PubMed |
| Cholesterol in Small VLDL | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.01 | 2E-11 | PubMed |
| Cholesteryl Esters to Total Lipids in Small LDL percentage | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.01 | 4E-11 | PubMed |
| White blood cell count | TTGGAGGGCAGACTAGCCCAGGCCC | β: 0.014 | 8E-10 | PubMed |