Total Cerebellar Volume

Other 9 variants 0 genes

Upload your DNA to see your personal risk score for Total Cerebellar Volume.

Associated Variants (9)
RSID Gene Risk Allele Odds Ratio Evidence
RS142355453 AACGGCATTTAAATGTGCTTTTAG exploratory
RS4926555 G exploratory
RS11111278 G exploratory
RS4301837 C exploratory
RS703547 G exploratory
RS72754248 A exploratory
RS1160248 C exploratory
RS1885983 A exploratory
RS71502077 A exploratory
Sign Up to Analyze Your DNA Log In