Rab44 Protein Levels

Other 5 variants 0 genes

Upload your DNA to see your personal risk score for Rab44 Protein Levels.

Associated Variants (5)
RSID Gene Risk Allele Odds Ratio Evidence
RS10424405 — G — exploratory
RS143649111 — A 0.76 moderate
RS185925209 — A 0.62 moderate
RS190919633 — A 0.4 moderate
RS143756287 — ACTCCTGACCGCAAGTGATC 0.13 moderate
Sign Up to Analyze Your DNA Log In