Mmp10 Protein Levels

Other 29 variants 0 genes

Upload your DNA to see your personal risk score for Mmp10 Protein Levels.

Associated Variants (29)
RSID Gene Risk Allele Odds Ratio Evidence
RS117884485 — T — exploratory
RS34482588 — AT — exploratory
RS11225506 — C — exploratory
RS9271364 — G — exploratory
RS573321 — A — exploratory
RS7107500 — A — exploratory
RS770071084 — CT 1.15 moderate
RS184354018 — T 1.15 moderate
RS139168339 — A 0.52 moderate
RS190163771 — A 0.44 moderate
RS1276261 — A 0.44 moderate
RS760757203 — A 0.43 moderate
RS188891296 — C 0.38 moderate
RS6940413 — A 0.36 moderate
RS185070417 — A 0.35 moderate
RS538776400 — G 0.32 moderate
RS17879960 — T 0.3 moderate
RS657043 — C 0.27 moderate
RS17359230 — T 0.24 moderate
RS573535413 — CTAATTTCTAATTATAGAAATTA 0.22 moderate
RS181503480 — C 0.21 moderate
RS543669129 — A 0.21 moderate
RS3025066 — C 0.21 moderate
RS17860942 — C 0.15 moderate
RS1051121 — T 0.13 moderate
RS201019284 — TA 0.13 moderate
RS35231465 — A 0.12 moderate
RS117994429 — G 0.12 moderate
RS681343 — T 0.12 moderate
Sign Up to Analyze Your DNA Log In