Idp Swi T2star Right Putamen

Other 18 variants 1 gene

Upload your DNA to see your personal risk score for Idp Swi T2star Right Putamen.

Associated Genes (1)
HFE
Associated Variants (18)
RSID Gene Risk Allele Odds Ratio Evidence
RS6751553 G exploratory
RS1371469 C exploratory
RS140659812 AGCATATGTATATATCTATACATACACAT exploratory
RS35348663 C exploratory
RS398465 C exploratory
RS1800562 HFE A 0.27 moderate
RS45470994 T 0.25 moderate
RS200928899 C 0.19 moderate
RS4428180 G 0.19 moderate
RS10430578 A 0.18 moderate
RS61844058 C 0.16 moderate
RS684214 T 0.14 moderate
RS465423 G 0.14 moderate
RS10508552 G 0.13 moderate
RS116272812 C 0.13 moderate
RS2461165 A 0.12 moderate
RS11196758 T 0.12 moderate
RS11778179 T 0.1 moderate
Sign Up to Analyze Your DNA Log In