Idp Swi T2star Left Putamen

Other 20 variants 1 gene

Upload your DNA to see your personal risk score for Idp Swi T2star Left Putamen.

Associated Genes (1)
HFE
Associated Variants (20)
RSID Gene Risk Allele Odds Ratio Evidence
RS9610638 C exploratory
RS1134634 C exploratory
RS2696422 C exploratory
RS10206543 A exploratory
RS140659812 AGCATATGTATATATCTATACATACACAT exploratory
RS14415 C exploratory
RS1800562 HFE A 0.27 moderate
RS45470994 T 0.23 moderate
RS4428180 G 0.2 moderate
RS200928899 C 0.19 moderate
RS10430578 A 0.18 moderate
RS61844058 C 0.17 moderate
RS567166639 A 0.15 moderate
RS465423 G 0.14 moderate
RS684214 T 0.14 moderate
RS10508552 G 0.13 moderate
RS116272812 C 0.12 moderate
RS11784870 A 0.1 moderate
RS11196758 T 0.1 moderate
RS7979705 T 0.1 moderate
Sign Up to Analyze Your DNA Log In