Ahsp Protein Levels

Other 18 variants 0 genes

Upload your DNA to see your personal risk score for Ahsp Protein Levels.

Associated Variants (18)
RSID Gene Risk Allele Odds Ratio Evidence
RS6592965 A exploratory
RS5754387 C exploratory
RS35788208 T exploratory
RS3095337 C exploratory
RS2858931 T exploratory
RS11759553 T exploratory
RS1000821 T exploratory
RS9837520 A exploratory
RS941718 C exploratory
RS875741 A exploratory
RS855791 G exploratory
RS7212367 A exploratory
RS590856 A exploratory
RS570013781 A 0.76 moderate
RS527259607 CCACGCCATGCATGCATAGGT 0.31 moderate
RS141706566 C 0.2 moderate
RS80215559 C 0.11 moderate
RS10742583 A 0.11 moderate
Sign Up to Analyze Your DNA Log In